|
Thermo Fisher
gene exp cited2 mm00516121 m1 Gene Exp Cited2 Mm00516121 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp cited2 mm00516121 m1/product/Thermo Fisher Average 87 stars, based on 1 article reviews
gene exp cited2 mm00516121 m1 - by Bioz Stars,
2026-05
87/100 stars
|
Buy from Supplier |
|
Bio-Techne corporation
cited-2 antibody (ja22) - bsa free Cited 2 Antibody (Ja22) Bsa Free, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cited-2 antibody (ja22) - bsa free/product/Bio-Techne corporation Average 90 stars, based on 1 article reviews
cited-2 antibody (ja22) - bsa free - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Novus Biologicals
mouse anti cited2 antibody ![]() Mouse Anti Cited2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse anti cited2 antibody/product/Novus Biologicals Average 90 stars, based on 1 article reviews
mouse anti cited2 antibody - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
cited2 floxed mice ![]() Cited2 Floxed Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cited2 floxed mice/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
cited2 floxed mice - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
R&D Systems
cited2 antibody ![]() Cited2 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cited2 antibody/product/R&D Systems Average 90 stars, based on 1 article reviews
cited2 antibody - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp foxo3b hs00921424 m1 ![]() Gene Exp Foxo3b Hs00921424 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp foxo3b hs00921424 m1/product/Thermo Fisher Average 97 stars, based on 1 article reviews
gene exp foxo3b hs00921424 m1 - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Addgene inc
cgttaactccaccatggaaggtaag rw gctctagattatatctttgtacagag ha cited2 pentr4 v5 dax1 phiv egfp xbai bamhi phiv egfp ha cited2 fw ![]() Cgttaactccaccatggaaggtaag Rw Gctctagattatatctttgtacagag Ha Cited2 Pentr4 V5 Dax1 Phiv Egfp Xbai Bamhi Phiv Egfp Ha Cited2 Fw, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cgttaactccaccatggaaggtaag rw gctctagattatatctttgtacagag ha cited2 pentr4 v5 dax1 phiv egfp xbai bamhi phiv egfp ha cited2 fw/product/Addgene inc Average 92 stars, based on 1 article reviews
cgttaactccaccatggaaggtaag rw gctctagattatatctttgtacagag ha cited2 pentr4 v5 dax1 phiv egfp xbai bamhi phiv egfp ha cited2 fw - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
R&D Systems
anti cited2 ab ![]() Anti Cited2 Ab, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti cited2 ab/product/R&D Systems Average 90 stars, based on 1 article reviews
anti cited2 ab - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp cited2 rn00586705 m1 ![]() Gene Exp Cited2 Rn00586705 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp cited2 rn00586705 m1/product/Thermo Fisher Average 91 stars, based on 1 article reviews
gene exp cited2 rn00586705 m1 - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti cited2 antibodies ![]() Anti Cited2 Antibodies, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti cited2 antibodies/product/Novus Biologicals Average 90 stars, based on 1 article reviews
anti cited2 antibodies - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
R&D Systems
cited2 ![]() Cited2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cited2/product/R&D Systems Average 92 stars, based on 1 article reviews
cited2 - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Abcam
antibodies to cited2 ![]() Antibodies To Cited2, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies to cited2/product/Abcam Average 99 stars, based on 1 article reviews
antibodies to cited2 - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 1. Verification of the interaction between rat PPAR and CITED2 in vitro. CITED2 was radiolabeled with [35S]methionine and incubated with bacterially expressed PPAR-MBP fusion for 1 h at 4 °C in the presence of amylose resin. Resin was collected and washed three times with cold radioimmune precipitation assay buffer. Bound MBP was eluted from the resin using 10 mM maltose in radioimmune pre- cipitation assay buffer for 1 min at 4 °C. Eluate was resolved on a 12% Tris-glycine gel, dried, and subjected to autoradiography. The image is representative of two independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: In Vitro, Incubation, Autoradiography
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 2. CITED2 interacts with the D domain of rPPAR. COS-1 cells were transiently transfected with the GAL4-DBD fused to rPPAR and VP16 activation domain with or without fused CITED2. Cells were treated with 50 M Wy-14,643 (Wy), 200 M CLA mixture, or Me2SO (DMSO) for 6 h. Domains containing no ligand activation were treated with Me2SO. Luciferase activity was determined and corrected for transfection efficiency and extraction yield. Each domain and treatment group was corrected to their corresponding VP16 value (100%). *, p 0.01 comparing CITED2 bar to corresponding VP16 bar. The graph is representative of three independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: Transfection, Activation Assay, Luciferase, Activity Assay, Extraction
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 3. CITED2 is a coregulator for PPAR. A, HepG2 cells were transiently transfected with expression vectors for rPPAR with CITED2 or empty vector control (pcDNA3) and a PPRE-driven lu- ciferase reporter. B, COS-1 cells were transiently transfected with rPPAR fused to the GAL4-DBD and CITED2 or empty vector control with GAL4-respon- sive reporter. Cells were treated with 50 M Wy-14,643 (Wy), 200 M CLA mixture, 100 M ciprofibrate, or Me2SO (DMSO) for 6 h. Luciferase activity was determined and corrected for transfection efficiency and extraction yield. All bars are corrected to untreated pcDNA3 level. *, p 0.05 compar- ing CITED2 bar to corresponding pcDNA3 bar. The graph is representative of three independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: Transfection, Expressing, Plasmid Preparation, Control, Luciferase, Activity Assay, Extraction
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 4. CITED2 acts as a dose-dependent coactivator of PPAR. A, COS-1 cells were transiently transfected with rPPAR fused to the GAL4-DBD and increasing amounts of CITED2. Cells were treated with 50 M Wy-14,643 for 6 h. Luciferase activity was deter- mined and corrected for transfection efficiency and extraction yield. Each treatment is corrected to luciferase activity with no CITED2 added (100%). Results show that CITED2 can act as a dose-dependent coactivator of PPAR in the presence or absence of ligand. *, p 0.05 comparing within a chemical treatment. Values in parentheses are relative luciferase units (rlu) for the accompanying data point. B, COS-1 cells were transiently transfected with rPPAR fused to the GAL4-DBD with or without CITED2. Cells were treated with 100 nM, 500 nM, 1 M, 5 M, 10 M, or 50 M Wy-14,643 for 6 h. Luciferase activity was determined and corrected for transfection efficiency and extraction yield. Each treatment is corrected to luciferase activity in the absence of Wy-14,643 (Me2SO (DMSO) at 100%). Graphs are representative of three independent experiments. CI, confidence interval.
Article Snippet: Immunoblotting was performed using a
Techniques: Transfection, Luciferase, Activity Assay, Extraction
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 5. CITED2 acts as a coactivator for PPAR but not PPAR. A, HepG2 cells were transiently transfected with expression vectors for each PPAR subtype with CITED2 or empty vector control and a PPRE-driven luciferase reporter. B, COS-1 cells were transfected with GAL4-DBD-PPAR fusions for all three subtypes with and without exogenous CITED2. Transfected cells were treated for 6 h with 50 M Wy-14,643 (Wy), 50 M tetradecylthioacetic acid (TTA), 10 M prostag- landin J2 (PGJ2), or Me2SO (DMSO). Luciferase activity was deter- mined and corrected for transfection efficiency and extraction yield. Each treatment is corrected to the luciferase activity for Me2SO for each subtype. *, p 0.05 comparing CITED2 bar with corresponding pcDNA3 bar. The graph is representative of three independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: Transfection, Expressing, Plasmid Preparation, Control, Luciferase, Activity Assay, Extraction
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 6. CITED2 is ubiquitously expressed in mouse tissues. Total RNA from 10 different mouse tissues and the SV40-transformed mouse hepatocytes was examined for CITED2 mRNA using reverse transcription-PCR. Equivalent amounts of total RNA were tested using primers designed for the 5 -end of mouse CITED2 mRNA. The graph is representative of three independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: Transformation Assay, Reverse Transcription
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 7. Ameliorated CITED2 expression leads to decreased PPAR activity. Undifferentiated 3T3-L1 preadipocytes were tran- siently transfected with an RNAi for CITED2 or vehicle control (pSu- per), pM-PPAR, and pFR-luciferase reporter and treated with 50 M Wy-14,643 (Wy), 100 M CLA mixture, 100 M ciprofibrate, or Me2SO (DMSO). Luciferase activity was measured and corrected for transfec- tion efficiency and extraction yield. Luciferase values were standard- ized to uninhibited (CITED2/) untreated (Me2SO) cells (100%). Graphs are representative of two independent experiments. *, p 0.05 comparing CITED2- to pSuper-transfected cells.
Article Snippet: Immunoblotting was performed using a
Techniques: Expressing, Activity Assay, Transfection, Control, Luciferase, Extraction
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 8. CITED2 and CITED2 sta- bly expressing hepatocytes. A, CITED2 inhibition was achieved using double- stranded RNAi molecules (pSUPER and CITED2). The inhibition was verified using Western blot. Lanes labeled pcDNA3 and CITED2 are MuSH wild type cells stably expressing exogenous CITED2. B, MuSH wild type cells that stably overexpress CITED2 or inhibited CITED2 were assayed for growth in re- sponse to Wy-14,643 (Wy). Cells were plated and treated with 50 M Wy-14,643 for 72 h and assayed for relative cell num- ber. Values were corrected for Me2SO (DMSO) control (100%) for the corre- sponding control cell line. The stable cell lines are pooled populations of trans- fected cells. Data represent two independ- ent experiments. neo, RNAi empty vector control. *, p 0.05 comparing untreated to treated cells within the same cell type; , p 0.05 comparing cell types within the same treatment group.
Article Snippet: Immunoblotting was performed using a
Techniques: Expressing, Inhibition, Western Blot, Labeling, Stable Transfection, Control, Plasmid Preparation
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 9. Regulation of gene expres- sion by peroxisome proliferators is affected by alterations in CITED2 ex- pression. A–E, MuSH wild type cells that were stably transfected with human CITED2 or CITED2 RNAi were treated with 50 M Wy-14,643, 100 M CLA, 100 M ciprofibrate (Cipro), or Me2SO (DMSO) for 6 h. Total RNA was isolated and used in real time reverse transcrip- tion-PCR for known PPAR-regulated genes: Angpl4 (A), HIF1 (B), FOXc2 (C), MKP-1 (D), and VEGF-D (E). The Me2SO level for each corresponding empty vector control was set to 100%. *, different than Me2SO-treated cells within the same cell line (p 0.05). F–J, data are identical to that presented in A–E with grouping based on treatment. *, different than con- trol stably transfected cells within the same treatment (p 0.05). The stable cell lines are pooled populations of trans- fected cells. Graphs are representative of two independent experiments.
Article Snippet: Immunoblotting was performed using a
Techniques: Stable Transfection, Transfection, Isolation, Plasmid Preparation, Control
Journal: Journal of Biological Chemistry
Article Title: Identification of the CREB-binding Protein/p300-interacting Protein CITED2 as a Peroxisome Proliferator-activated Receptor α Coregulator
doi: 10.1074/jbc.m401489200
Figure Lengend Snippet: FIG. 10. Analysis of altered gene expression in the CITED2 cells. Genes that were significantly regulated in gene expression microarrays (CITED2/pcDNA3, Table II) were examined using Pathway Assist (Version 2.01). The pathway was built by looking for common regulators of the genes shown in Table II, and the predominant cluster is depicted. The lines and arrows depict observations on regulation of gene expression (, increased expression; , decreased expression) from the literature. The effects of CITED2 overexpression on the amount of mRNA in the microarray experiments are shown (black, significantly increased; gray, significantly decreased; white, no significant effect observed). Following creation of this cluster, the proteins in the gradient filled ovals were included (PPAR, PPAR, Angptl4, and HIF1), and the connections were determined by Pathway Assist or by manually adding (PPAR and CITED2 interaction). EGF, epidermal growth factor; TGF, transforming growth factor; DCN, decorin; AQP5, aquaporin 5; TNF, tumor necrosis factor; IFG1R, insulin-like growth factor I receptor; IL2, interleukin 2; IGFBP2, insulin-like growth factor-binding protein 2; IFN, interferon; LTBP1, latent transforming growth factor--binding protein 1; EPS15, epidermal growth factor receptor pathway substrate 15; TGM2, transglutaminase 2; UCHL1, ubiquitin carboxyl-terminal hydrolase L1; FIGF, c-fos-induced growth factor; GHRL, growth hormone receptor, long form; IL13R, interleukin 13 receptor; GH1, growth hormone 1; ADCY8, adenylate cyclase 8; TSA, trichostatin A; MGP, matrix -carboxyglutamate protein.
Article Snippet: Immunoblotting was performed using a
Techniques: Gene Expression, Expressing, Over Expression, Microarray, Binding Assay, Ubiquitin Proteomics
Journal: Cells
Article Title: Acute Depletion of Cited2 in Embryonic Stem Cells Disrupts Gene Networks Controlling Self-Renewal, Homeostasis, and Early Cell Fate Commitment
doi: 10.3390/cells15050450
Figure Lengend Snippet: Cited2 depletion alters gene expression and modulates the activin/nodal signaling pathway. ( A ) Principal Component Analysis (PCA) of the entire normalized array datasets. After normalization of the entire transcriptome dataset obtained from undifferentiated C2 fl/fl [Cre]ESC treated with ethanol (Undiff. D0/Ethanol), 4HT for 48 h (Undiff. D0/4HT), and differentiated for 4 days upon treatment with ethanol (D4/Ethanol) or 4HT (D4/4HT) for the first 48 h. Each circle represents an individual sample. PC1 shows the main variability among the transcriptome differences and PC2 the second largest variability. ( B ) Volcano plot of differential gene expression in control C2 fl/fl [Cre] ESC treated with ethanol (vehicle) or 4HT for 48 h. Only the genes with a significant differential expression (adjusted p value < 0.05) and a positive or negative log2 fold-change >1 with a log2 were plotted. Each point represents the average value of one transcript in three biological independent experiments. Names of the top ten downregulated and upregulated genes are indicated. ( C ) Activity of the luciferase reporter (ARE)3-lux in C2 fl/fl [Cre]ESC treated with ethanol (Undiff. D0/Ethanol), 4HT for 48 h (Undiff. D0/4HT). Gene expression in Undiff. D0/Ethanol ESC was set to 1. Results are presented as mean ± SEM from three independent biological replicates, each measured in technical duplicate. ( D ) Luciferase activity of the (ARE)3-lux reporter in E14TG2A mouse ESC co-transfected with either pPyCAGIP-flagCITED2 (orange bars) or pPyCAGIP control vector (blue bars), with or without pCMV-flag-Smad2 or pCMV-flag-FoxH1. Cells were either left unstimulated or stimulated 24 h post-transfection with 30 ng/mL Activin A for 24 h. Reporter activity in cells transfected with (ARE)3-lux and control vectors, without Activin A stimulation, was set to 1. Data represent the mean ± SEM from three independent biological experiments, each measured in technical duplicate.
Article Snippet:
Techniques: Gene Expression, Control, Quantitative Proteomics, Activity Assay, Luciferase, Transfection, Plasmid Preparation
Journal: Cells
Article Title: Acute Depletion of Cited2 in Embryonic Stem Cells Disrupts Gene Networks Controlling Self-Renewal, Homeostasis, and Early Cell Fate Commitment
doi: 10.3390/cells15050450
Figure Lengend Snippet: Identification of biological processes affected in Cited2 -depleted cells. ( A ) Relative expression of the indicated genes determined by qRT-PCR in C2 fl/fl [Cre]ESC treated either with treated ethanol or 4HT for 48 h (Undiff. D0) and in cells differentiated for 4 days upon treatment with ethanol or 4HT for the first 48 h (Diff. D4). Gene expression in ethanol/vehicle conditions was set to 1. Bars represent mean ± SEM of three independent biological triplicates, each measured in technical duplicate. NS means “not significant”. ( B ) Relative expression of Bmi1 , Ennp2 , Nav2 and Zic5 genes by qRT-PCR Cited2 conditional-null (cKO) in neural progenitor-stage of embryos at E15.5. as previously described . Bars represent mean ± SEM of at least three independent biological triplicates, each measured in technical duplicate. NS means “not significant”. ( C ) Top gene ontology biological process terms for the genes downregulated (left) and upregulated (right) by Cited2 depletion at D0 of differentiation determined using Enrichr [ , ].
Article Snippet:
Techniques: Expressing, Quantitative RT-PCR, Gene Expression
Journal: Cells
Article Title: Acute Depletion of Cited2 in Embryonic Stem Cells Disrupts Gene Networks Controlling Self-Renewal, Homeostasis, and Early Cell Fate Commitment
doi: 10.3390/cells15050450
Figure Lengend Snippet: Cited2 and p300/CBP exhibit limited functional overlap in mouse ESC. ( A ) pNanog-L activity in E14TG2A ESC co-transfected with pPyCAGIP-flagCITED2 (black bar) or pPyCAGIP (white bar), with or without pcDNA3-p300 (blue bars) or pcDNA3-CBP (orange bars). Gene expression in cells transfected with pNanog-L and control vector was set to 1. Results are presented as the mean ± SEM of three biological experiments, each measured in technical duplicate. ( B ) Cited2 -depletion in ESC modestly increased global histone acetyltransferase activity. C2 fl/fl [Cre] ESC maintained in undifferentiating conditions, treated with ethanol (Undiff. D0/Ethanol) or 4HT (Undiff. D0/4HT) for 48 h. Cell extracts were subjected to immunoprecipitation using either an antibody specific to p300 (IP α-p300) or an anti-Flag antibody as a control (Control IP). Immunoprecipitated proteins were used to assess the histone acetyltransferase (HAT) activity, which were normalized to the total protein content. 40% of the total whole lysate used for IP (Input) was used for HAT assay. Results are shown as mean ± SEM from at least two biological replicates, each measured in technical duplicate.
Article Snippet:
Techniques: Functional Assay, Activity Assay, Transfection, Gene Expression, Control, Plasmid Preparation, Immunoprecipitation, HAT Assay
Journal: Cells
Article Title: Acute Depletion of Cited2 in Embryonic Stem Cells Disrupts Gene Networks Controlling Self-Renewal, Homeostasis, and Early Cell Fate Commitment
doi: 10.3390/cells15050450
Figure Lengend Snippet: Cited2 depletion in ESC increases the risk for DNA damage. ( A ) Relative expression of p53-target and other upregulated genes and DNA repair related genes determined by qRT-PCR in C2 fl/fl [Cre]ESC treated either with treated ethanol or 4HT for 48 h. Gene expression in ethanol/vehicle conditions was set to 1. Means were compared with the control condition using a t -test considering the p value threshold of 0.05 for significance. Bars represent mean ± SEM of three independent biological triplicates, each measured in technical duplicate. NS means “not significant”. ( B ) Detection of γH2AX nuclei in C2 fl/fl [cre] cells cultured in undifferentiating conditions treated with 1 µM 4HT (4HT) for 16 h, 30 min with 100 µM hydrogen peroxide (H 2 O 2 ) or ethanol as a control, using an anti-γH2AX antibody (green). Nuclei were stained with DAPI (blue). Nuclei and the γH2AX speckles were determined (Segment.) using the segmentation pipeline in Cell Profiler. Scale bars represent 10 µm. ( C ) Images acquired as described in B, were used to count the number of γH2AX speckles per nucleus. ( D ) The mean of the intensity of the γH2AX speckles per nucleus was also determined. Means were compared with the control condition using a t -test considering the p value threshold of 0.05 for significance. The results are from three independent biological experiments, and 321 to 411 nuclei were analyzed per condition. ( E ) γH2AX protein levels determined by western blotting in protein extracts from cells treated as in B. Bottom panel: Total protein transferred on the PVDF membrane stained with No-Stain whole protein labelling (Thermo Fisher, A44717) used to control for loading. ( F ) Proliferation of C2 fl/fl [Cre]ESC treated either with treated ethanol and DMSO vehicle (Ethanol/DMSO), 4HT and DMSO (4HT/DMSO) or 4HT plus increasing concentrations of pifithrin-α (4HT/pifithrin-α). Left panel: representative images of the colonies at 48 h after treatment. Scales bars, 250 µm. Right panel: Cell counts at 48 h (mean ± SEM; n = 9 wells per group, from three independent biological triplicates, each measured in technical triplicate). Data were analyzed by one-way ANOVA followed by Dunnett’s test versus 4HT/DMSO (F (4,40) ) = 3.194, p = 0.0229). NS means “not significant”.
Article Snippet:
Techniques: Expressing, Quantitative RT-PCR, Gene Expression, Control, Cell Culture, Staining, Western Blot, Membrane
Journal: PLoS ONE
Article Title: (-)-Phenserine Attenuates Soman-Induced Neuropathology
doi: 10.1371/journal.pone.0099818
Figure Lengend Snippet: Information on primers and probes used in the study.
Article Snippet: Cited2 , Rat ,
Techniques:
Journal: PLoS ONE
Article Title: (-)-Phenserine Attenuates Soman-Induced Neuropathology
doi: 10.1371/journal.pone.0099818
Figure Lengend Snippet: Administration of (−)-phenserine thirty minutes prior to soman differentially modulates gene expression in the piriform cortex three hours after soman.
Article Snippet: Cited2 , Rat ,
Techniques: Gene Expression
Journal: Journal of Endocrinology
Article Title: CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor
doi: 10.1677/joe-06-0083
Figure Lengend Snippet: Figure 1 Representative sections of human embryonic adrenal glands at 8 weeks of gestation. Panel A: negative control without primary antibody (adZadrenal, 100!). Panel B: immunostaining with antibodies to CITED2 revealed that CITED2 is located in the definitive zone (arrows, 100!). Panel C: high magnification of a negative control demonstrates nuclear morphology in the definitive zone (1000!). Panel D: high magnification of a representative section of the definitive zone. Predominantly, small nuclei were stained with an antibody to CITED2 (arrows, 1000!). Panel E: immunohistochemistry with an antibody to 17-a-hydroxylase identified the fetal zone (zF) while the definitive zone (zD) did not stain (100!). Panel F: chromogranin A immunoreactive cells in the outside margin of the adrenal gland (arrows, 100!).
Article Snippet: Then cells were incubated with monoclonal
Techniques: Negative Control, Immunostaining, Staining, Immunohistochemistry
Journal: Journal of Endocrinology
Article Title: CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor
doi: 10.1677/joe-06-0083
Figure Lengend Snippet: Figure 2 Representative sections of stained normal adult adrenal glands and adrenocortical carcinomas. Panel A: negative control for normal adult adrenal gland without primary antibody (40!). Panel B: normal adult adrenal gland stained for CITED2. Arrows indicate immunoreactivity in the zonae glomerulosa and reticularis at the corticomedullary junction (40!). Panel C: adrenocortical carci- noma stained for CITED2 showed strong nuclear expression of CITED2 (200!). Panel D: gel of RT-PCR analysis of mRNA from normal adult human adrenal cortex (lane 2) and from NCI-H295R cells (lane 3) the 69 bp fragments corresponded to the predicted amplification product of CITED2. As control for PCR we used RNA skipping the reverse transcription reaction (lane 1).
Article Snippet: Then cells were incubated with monoclonal
Techniques: Staining, Negative Control, Expressing, Reverse Transcription Polymerase Chain Reaction, Control, Reverse Transcription
Journal: Journal of Endocrinology
Article Title: CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor
doi: 10.1677/joe-06-0083
Figure Lengend Snippet: Figure 3 Regulation of CITED2-promotor activity and mRNA-level in NCI-H295R cells. Panel A: relative activity of the CITED2- promotor in NCI-H295R cells after exposure to bFGF in different concentrations either with or without PD98059 for 48 h. Panel B: relative levels of CITED2-mRNA in NCI-H295R cells after exposure to bFGF in different concentrations for 8 h. Panel C: effects of ACTH and forskolin (Forsk) on the CITED2-promotor activity after 48 h of stimulation (left panel) or on the CITED2-mRNA levels (right panel) after 8 h of stimulation in NCI-H295R cells. In all panels P-values indicate significant differences from the control (CNT).
Article Snippet: Then cells were incubated with monoclonal
Techniques: Activity Assay, Control
Journal: Journal of Endocrinology
Article Title: CITED2 is expressed in human adrenocortical cells and regulated by basic fibroblast growth factor
doi: 10.1677/joe-06-0083
Figure Lengend Snippet: Figure 4 Immunofluorescence technique demonstrates CITED2 protein expression in NCI-H295R cells. Panel A: unstimulated control. Blue fluorescence dye DAPI marks nuclei. CITED2 protein is represented by a green fluorescence signal in the nuclei. Panel B: exposure of NCI-H295R cells for 24 h to bFGF (10 ng/ml) increased CITED2 nuclear expression in comparison with the control. Panel C: exposure of NCI-H295R cells to bFGF (10 ng/ml) in combination with PD98059 (20 mM) for 24 h attenuated CITED2 nuclear fluorescence signal in comparison with the stimulation with bFGF (10 ng/ml) alone. Panel D: exposure of NCI-H295R cells to ACTH (100 nM) for 24 h did not exert an effect on CITED2-protein expression in comparison with the control.
Article Snippet: Then cells were incubated with monoclonal
Techniques: Expressing, Control, Comparison
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Schematic showing the rat placentation site. Invaded trophoblast cells are depicted in green. b . Relative expression of Cited2 transcripts in the ectoplacental cone ( EPC ), whole placenta ( P ), junctional zone ( JZ ), and labyrinth zone ( LZ ) of the rat placenta during gestation. Values depicted were normalized to EPC 9.5 samples. c . Relative expression of Cited2 transcript in postnatal day 1 ( PND1 ) rat neonatal tissues and gd 14.5 JZ tissue. d . Relative expression of Cited2 transcripts within the uterine-placental interface during gestation. e . In situ hybridization showing Cited2 transcript distribution (top left) and Cited2 and Prl7b1 (invasive trophoblast marker) transcript co-localization in rat gestation day ( gd ) 18.5 placentation site (bottom left). Higher magnification images of the area outlined by a yellow rectangle (bottom left) are shown to the right. Scale bar=500 μm (left panels), scale bar=100 μm (right panels). Uterine-placental interface ( UPI ), spiral artery ( SpA ). The histograms presented in panels b, c, and d represent means ± SEM, n=5-10, 3-6 pregnancies. One-way ANOVA, Tukey’s post hoc test, * p < 0.05, ** p < 0.01, **** p<0.0001.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: Expressing, In Situ Hybridization, Marker
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Schematic of the Cited2 wild type and null alleles. A 1477 bp deletion was generated using CRISPR /Cas9 genome editing. The deletion included the entire coding sequence of the Cited2 gene. b . Western blot for CITED2 protein in rat junctional zone tissue samples from Cited2 +/- x Cited2 +/- breeding on gd 18.5. c . Fetal and placental weights from Cited2 +/- x Cited2 +/- breeding for the rat. Values represent mean ± SEM, n=17-35, unpaired t-test, **p<0.01, ***p<0.001, **** p<0.0001.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: Generated, CRISPR, Sequencing, Western Blot
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Immunohistological analysis of vimentin in wild type ( WT, +/+ ) and null (-/-) placentas from Cited2 +/- x Cited2 +/- breeding on gd 18.5. Scale bar=1000 μm. UPI uterine-placental interface, JZ junctional zone, LZ labyrinth zone. b . JZ and LZ weights from Cited2 +/- x Cited2 +/- breeding on gd 14.5 and gd 18.5. c . Simplified schematic depicting the strategy for achieving trophoblast specific CITED2 knockdown in vivo. d . Relative expression of Cited2 transcripts in control ( CTRL ) and CITED2 shRNA-exposed gd 14.5 JZ. e . JZ, LZ and fetal weights from control and gd 14.5 trophoblast specific Cited2 knockdown. CTRL, control knockdown, KD, Cited2 knockdown. Shown are mean values ± SEM, n=12-20, unpaired t-test, **p<0.01, **** p<000.1.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: Knockdown, In Vivo, Expressing, Control, shRNA
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Significantly upregulated and downregulated transcripts from RNA-seq analysis of rat 14.5 junctional zone tissue from wild type (+/+) and Cited2 null (-/-) rats, n=4, log 2 -fold change in either direction>1.5, p<0.05. b . Heatmap showing select transcripts from RNA-seq analysis of wild type (+/+) and Cited2 null (-/-) rat 14.5 junctional zone tissue. c . Significantly upregulated and downregulated transcripts from RNA-seq analysis of differentiated wild type (+/+) and Cited2 null (-/-) rat trophoblast stem ( TS ) cells, n=3, log 2 -fold change in either direction>1.5, p<0.05. d . Heatmap showing select transcripts from RNA-seq analysis of differentiated rat TS cells from RNA-seq analysis of wild type (+/+) and Cited2 null (-/-) differentiated TS cells. e . Gene Ontology ( GO ) enriched terms for DEGs from wild type (+/+) versus Cited2 null (-/-) rat 14.5 junctional zone RNA-seq analysis. f . GO enriched terms for DEGs from wild type (+/+) versus Cited2 null (-/-) rat TS cell RNA-seq analysis.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: RNA Sequencing
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Representative images of wild type (+/+) and Cited2 null (-/-) rat gd 13.5, 15.5 and 18.5 placentation sites immunostained for cytokeratin (green). Scale bars=1000 μm. b . Relative expression of transcripts associated with invasive trophoblast ( Prl7b1 ) from wild type (+/+) and Cited2 null (-/-) gd 13.5 decidual tissue and uterine placental interface tissue at gd 15.5 and 18.5. Graphs depict mean values ± SEM, n=11-24, unpaired t-test, *p<0.05. c . In situ hybridization showing Ceacam9 (red) and Prl7b1 (invasive trophoblast marker, green) transcript localization in gd 15.5 wild type (+/+) and Cited2 null (-/-) rat placentation sites, scale bar=1000 μm. d . Relative expression of Ceacam9 transcripts in gd 15.5 uterine placental interface tissue. Shown are mean values ± SEM, n=12-14, unpaired t-test, **p<0.01. Uterine placental interface ( UPI ), decidua ( DEC ), junctional zone ( JZ ), labyrinth zone ( LZ ).
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: Expressing, In Situ Hybridization, Marker
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: Single cell-RNA sequencing was performed on wild type (+/+) and Cited2 null (-/-) gd 18.5 uterine-placental interface tissue samples. a . UMAP plot showing cell clustering in wild type (+/+) and Cited2 null (-/-) gd 18.5 uterine-placental interface tissue. UD, unidentified cluster. b . Number of analyzed cells in the invasive trophoblast cell cluster. Graph represents mean values ± SEM, n=3, unpaired t-test, *p<0.05. c . Bar plot showing select DEGs in the invasive cell cluster (upregulated shown in red; downregulated shown in blue). d . Gene Ontology enriched terms for DEGs from the invasive trophoblast cell cluster.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: RNA Sequencing
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . Schematic of the experimental timeline for hypoxia exposure. b . Representative images of wild type (+/+) and Cited2 null (-/-) rat gd 13.5 placentation sites exposed to ambient or hypoxic (10.5% oxygen) conditions. Sections were immunostained for cytokeratin (green), perforin (red), and DAPI (blue). Scale bar=500 μm. Uterine placental interface ( UPI ), Decidua ( DEC ), Junctional Zone ( JZ ), labyrinth zone ( LZ ), and Spiral artery ( SpA ). c . Depth of invasion was quantified, and fold changes calculated for hypoxic relative to ambient conditions, n=5-9. d . Resorption rate assessed on gd 18.5 for individual genotypes from Cited2 +/- females bred to Cited2 +/- males and exposed to ambient of hypoxic conditions, n=20-33. e . Schematic of the experimental timeline for polyinosinic:polycytidylic acid ( polyI:C ) treatment, f . Relative expression of Isg15, Mx2, Ifi27I2b , and Oasl2 in junctional zone tissue from control (saline treated; CTRL ) and polyI:C treated ( IC ) wild type (+/+) and Cited2 null (-/-) animals.; n=8-17. Shown are mean values ± SEM, one-way analysis of variance, Tukey’s post-hoc test. *p<0.05, **p <0.01, ***p <0.001. ****p <0.0001.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: Expressing, Control, Saline
Journal: bioRxiv
Article Title: CITED2 IS A CONSERVED REGULATOR OF DEEP HEMOCHORIAL PLACENTATION
doi: 10.1101/2022.06.15.496287
Figure Lengend Snippet: a . In situ hybridization showing CITED2 transcript localization in first trimester human placenta. C ITED2 transcripts (black) were co-localized with E-cadherin ( CDH1 , red; marker of cytotrophoblast progenitor cells) transcripts. High magnification image of an EVT cell column and villus (yellow box) are shown in the right panel. The scale bar in the magnified image is 100 μm. b . Schematic showing human trophoblast stem ( TS ) cell differentiation from stem/progenitor state to EVT cells. c . Relative expression of CITED2 and EVT cell signature transcripts ( MMP2 and HLA-G ) in human TS cells in the stem state and following eight days of EVT cell differentiation, n=5. d . Relative expression of CITED2 transcript levels in EVT cells expressing control ( CTRL ) shRNA or CITED2 shRNA, n=3. Graphs represent mean values ± SEM, unpaired t-test, *p<0.05, ***p <0.001. ****p <0.0001. e . Significantly upregulated and downregulated transcripts from RNA-seq analysis of CTRL shRNA versus CITED2 shRNA samples, n=3, and log 2 -fold change ( FC ) in either direction>1.5, p<0.05. f . Heatmap showing select transcripts from RNA-seq analysis of CTRL shRNA versus CITED2 shRNA treated EVT cells. g . Gene Ontology enriched terms for DEGs from CTRL shRNA versus CITED2 shRNA treated EVT cells.
Article Snippet: Membranes were subsequently blocked with 5% BSA in Tris buffered saline with 0.1% Tween 20 ( TBST ) and probed using antibodies specific for
Techniques: In Situ Hybridization, Marker, Cell Differentiation, Expressing, Control, shRNA, RNA Sequencing
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a , b ) Effects of shRNA-mediated knockdown (KD) of GCN5 in the liver of C57BL/6J mice on hepatic gluconeogenic gene expression under the fasted (24 h) condition ( a ) or on plasma glycemia either under fasted (6 or 24 h) or fed conditions ( a ) or after pyruvate administration ( b ). ( c ) IP and immunoblot analysis of acetylated (Ac) PGC-1α in the liver of C57BL/6J mice injected with an adenovirus for GCN5 shRNA and deprived of food for 24 h. ( d ) Effects of shRNA-mediated depletion of GCN5 on gluconeogenic gene expression and glucose production in primary mouse hepatocytes exposed (or not) to pCPT-cAMP for 16 h. ( e ) IP and immunoblot analysis of acetylated PGC-1α in primary hepatocytes expressing FLAG–PGC-1α with or without GCN5 depletion and incubated in the absence or presence of pCPT-cAMP for 6 h. ( f ) Effects of GCN5 depletion on CITED2-dependent enhancement of gluconeogenic gene expression induced by pCPT-cAMP (100 μM, 6 h) in primary hepatocytes. ( g ) Effects of GCN5 knockdown on PGC-1α-induced gluconeogenic gene expression with or without CITED2 overexpression in primary hepatocytes. All quantitative data are means±s.e.m. ( n =7 ( a , b ) or 3 ( d , f , g )). Statistical analysis was performed with the unpaired Student's t -test ( a ) or ANOVA followed by Bonferroni's post hoc test ( b , d , f , g ). * P <0.05, ** P <0.01 compared with control or as indicated. Data in c , e are representative of at least three independent experiments. Adenoviral vectors encoding GCN5 shRNA, FLAG–PGC-1α or CITED2 were used for these experiments. ANOVA, analysis of variance.
Article Snippet:
Techniques: shRNA, Expressing, Western Blot, Injection, Incubation, Over Expression
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) Quantitative RT-PCR analysis of Gcn5 and gluconeogenic gene expression in primary hepatocytes infected with adenoviruses for WT or ΔAT mutant forms of GCN5 and exposed to pCPT-cAMP for 6 h. ( b ) Effects of forced expression of WT or ΔAT forms of GCN5 together with CITED2 on pCPT-cAMP-induced gluconeogenic gene expression in primary hepatocytes. ( c – e ) Effects of GCN5 overexpression with or without that of CITED2 in the liver of C57BL/6J mice on glycemia under the fasted (6 h) condition ( c ) or after pyruvate administration ( e ) as well as on hepatic gluconeogenic gene expression under the fasted (24 h) condition ( d ). All data are means±s.e.m. ( n =3 ( a , b ), 10 ( c ) or 8 ( d , e )). Statistical analysis was performed with ANOVA followed by Bonferroni's post hoc test. * P <0.05, ** P <0.01 compared with control or as indicated; † P <0.05, †† P <0.01 versus CITED2. Adenoviral vectors encoding GCN5(WT), GCN5(ΔAT) or CITED2 were used for these experiments. ANOVA, analysis of variance; RT–PCR, PCR with reverse transcription.
Article Snippet:
Techniques: Quantitative RT-PCR, Expressing, Infection, Mutagenesis, Over Expression, Reverse Transcription Polymerase Chain Reaction
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) ChIP-qPCR analysis of the occupancy of G6pc and Pck1 promoters with GCN5 in cells depleted of CITED2 and exposed to pCPT-cAMP for the indicated times. ( b ) ChIP-qPCR analysis of the occupancy of the G6pc promoter with CBP or epigenomic marks in cells depleted of GCN5 or CITED2 and exposed to pCPT-cAMP for the indicated times. ( c ) ChIP-qPCR analysis of the occupancy of the G6pc promoter with GCN5, CBP or epigenomic modifications in cells depleted of PGC-1α and exposed to pCPT-cAMP for 6 h. ( d ) ChIP-qPCR analysis of the occupancy of the G6pc promoter with FLAG-tagged PGC-1α, HNF-4α or FLAG-FoxO1 in cells depleted of GCN5, CITED2 or PGC-1α and exposed to pCPT-cAMP for 6 h. All data are means±s.e.m. ( n =3). * P <0.05, ** P <0.01 versus control or as indicated (ANOVA with Bonferroni's post hoc test). Adenoviral vectors encoding GCN5, CITED2 or PGC-1α shRNAs, FLAG–PGC-1α or FLAG-FoxO1 were used for these experiments. ANOVA, analysis of variance; qPCR, quantitative PCR.
Article Snippet:
Techniques: Real-time Polymerase Chain Reaction
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) Immunoblot analysis of the effects of FLAG-CITED2 expression or pCPT-cAMP treatment (for 1 h) in AML12 cells on the HAT activity of immunoprecipitated Myc epitope-tagged GCN5 assayed in vitro with histone H3 as substrate. ( b ) Effects of haemagglutinin epitope (HA)-tagged CITED2 expression in AML12 cells on the acetyltransferase activity of immunoprecipitated FLAG-GCN5 assayed in vitro with histone H3 and a His 6 -tagged NH 2 -terminal fragment of PGC-1α as substrates. ( c ) Interaction of GCN5 with PGC-1α or histone H3 was assessed by PLA in primary hepatocytes expressing either Myc-GCN5 with FLAG–PGC-1α (top) or FLAG-GCN5 alone (bottom) and exposed (or not) to pCPT-cAMP for 1 h. PLA signals (red dots) represent proximity (<40 nm) of GCN5 and either PGC-1α (top) or histone H3 (bottom). Nuclei are stained blue with 4′,6-diamidino-2-phenylindole. Scale bars, 10 μm. All data are representative of at least three independent experiments. Adenoviral vectors were used for these experiments.
Article Snippet:
Techniques: Western Blot, Expressing, Activity Assay, Immunoprecipitation, In Vitro, Staining
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) Effects of PKA inhibition with H89 (20 μM, 6 h) on gluconeogenic gene expression induced by overexpression of PGC-1α with or without CITED2 in primary hepatocytes. Data are means±s.e.m. ( n =3). ** P <0.01 (ANOVA with Bonferroni's post hoc test). ( b ) Immunoblot analysis of the effects of HA-CITED2 expression or pCPT-cAMP treatment (10 or 30 min) on phosphorylation of FLAG-GCN5 in AML12 cells as assessed with antibodies to phosphorylated PKA substrates. ( c ) Effects of CITED2 depletion on pCPT-cAMP-induced phosphorylation of FLAG-GCN5 and other PKA substrates as well as on the dephosphorylation of CRTC2 in primary hepatocytes. ( d , e ) IP and immunoblot analysis of the interaction of FLAG-GCN5 with Myc-PKAC and HA-CITED2 ( d ) as well as of the effect of CITED2 knockdown on the interaction of FLAG-GCN5 with PKAC ( e ) in AML12 cells. ( f ) Effect of siRNA-mediated PKAC depletion in AML12 cells on basal and CITED2-induced HAT activity of FLAG-GCN5 as assessed by in vitro assay. ( g ) Effect of PKAC overexpression in AML12 cells on HAT activity of FLAG-GCN5 measured in vitro . A Myc-PKAC plasmid and PKAC siRNA were introduced into cells by transfection, whereas adenoviral vectors were used to introduce other exogenous proteins or shRNAs in these experiments. Data are representative of at least three independent experiments. ANOVA, analysis of variance; siRNA; small interfering RNA.
Article Snippet:
Techniques: Inhibition, Expressing, Over Expression, Western Blot, De-Phosphorylation Assay, Activity Assay, In Vitro, Plasmid Preparation, Transfection, Introduce, Small Interfering RNA
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) AML12 cells expressing FLAG-tagged GCN5(WT) or GCN5(S275A) were exposed to pCPT-cAMP with or without H89 for 30 min and then subjected to IP with antibodies to phosphorylated PKA substrates followed by immunoblot analysis with antibodies to FLAG. ( b ) Effect of the S275A mutation of FLAG-GCN5 on in vitro acetylation of histone H3 in AML12 cells treated with pCPT-cAMP (1 h). ( c ) Acetylation of FLAG–PGC-1α in AML12 cells expressing GCN5(WT) or GCN5(S275A) with or without HA-CITED2. ( d ) Effects of the S275D mutation of GCN5 on histone H3 and PGC-1α acetyltransferase activities in AML12 cells. ( e ) Effect of the S275D mutation of FLAG-GCN5 on interaction with V5-tagged PGC-1α in AML12 cells. ( f ) Effects of the S275A and S275D mutations of FLAG-GCN5 on interaction with HA-CITED2 in AML12 cells. ( g ) The S275A mutation of GCN5 blocks the pCPT-cAMP-induced dissociation of HA-CITED2 from FLAG-GCN5 in AML12 cells. All data are representative of at least three independent experiments. Adenoviral vectors were used for these experiments.
Article Snippet:
Techniques: Expressing, Western Blot, Mutagenesis, In Vitro
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) Effects of forced expression of GCN5(WT) or GCN5(S275A) together with CITED2 on gluconeogenic gene expression in primary hepatocytes exposed (or not) to pCPT-cAMP (6 h). ( b , c ) Effects of forced expression of GCN5(S275D) on gluconeogenic gene expression ( b ) and glucose production ( c ) in primary hepatocytes exposed (or not) to pCPT-cAMP (16 h). ( d ) qRT-PCR analysis of G6pc and Pck1 expression in primary mouse hepatocytes infected with adenoviruses encoding CITED2 shRNA or GCN5(S275D) and exposed (or not) to pCPT-cAMP for 6 h. ( e , f ) Effects of GCN5(S275D) expression in the liver of C57BL/6J mice on gluconeogenic gene expression ( e ) and plasma glycemia ( f ) under the fasted (24 h) condition. All data are means±s.e.m. ( n =3 ( a – d ) or 7 ( e , f )). * P <0.05, ** P <0.01 versus control or as indicated (ANOVA with Bonferroni's post hoc test ( a – d ) or unpaired Student's t -test ( e , f )). Adenoviral vectors were used for these experiments. RT–PCR, PCR with reverse transcription. ANOVA, analysis of variance.
Article Snippet:
Techniques: Expressing, Quantitative RT-PCR, Infection, shRNA, Reverse Transcription Polymerase Chain Reaction
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: ( a ) Analysis of GCN5 phosphorylated at Ser 275 in the liver of db/db or db/m (control) mice or of C57BL/6J mice fed NC or a HFD. All mice were deprived of food for 16 h before analysis. Liver extracts were subjected to IP with antibodies to Ser 275 -phosphorylated GCN5 followed by immunoblot analysis with antibodies to GCN5. ( b , c ) Effects of expression of GCN5(WT), GCN5(S275A) or GCN5(S275D) in the liver of db/db mice on plasma glucose concentration under fed or fasted (24 h) conditions ( b ) as well as on hepatic expression of G6pc and Pck1 under the fasted (24 h) condition ( c ). ( d ) Effect of CITED2 depletion on GCN5 phosphorylation at Ser 275 in the liver of db/db mice deprived of food for 24 h. All quantitative data are means±s.e.m. ( n =7 ( b , c )). * P <0.05, ** P <0.01 (ANOVA with Bonferroni's post hoc test). Data in a , d are representative of at least three independent experiments. Adenoviral vectors were used for these experiments. ANOVA, analysis of variance; NC, normal chow.
Article Snippet:
Techniques: Western Blot, Expressing, Concentration Assay
Journal: Nature Communications
Article Title: The GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a cAMP-induced substrate switch
doi: 10.1038/ncomms13147
Figure Lengend Snippet: (left) In the fed state, the GCN5-CITED2-PKA signalling module is not assembled as a result of the low level of CITED2 expression maintained in the absence of glucagon signalling and the insulin-induced inhibition of GCN5-CITED2 interaction. GCN5 is not phosphorylated at Ser 275 and therefore acetylates PGC-1α rather than histone H3, resulting in inactivation of PGC-1α and consequent suppression of gluconeogenic gene transcription. (middle) In the fasted state or diabetes, glucagon-cAMP signalling increases the expression of CITED2 and GCN5 and thereby promotes formation of the GCN5-CITED2-PKA signalling module, within which PKA activated by cAMP phosphorylates GCN5 at Ser 275 . (right) Phosphorylation of GCN5 induces a substrate switch from PGC-1α to histone H3 and a consequent increase in H3K9 acetylation and the deacetylation-mediated activation of PGC-1α at gluconeogenic gene promoters. The increase in the amount of H3K9ac promotes further epigenetic changes and the recruitment of transcriptional regulators required for initiation of gene transcription, whereas activated PGC-1α functions as a co-activator for gluconeogenic transcription factors such as FoxO1 and HNF-4α. These two effects act cooperatively to activate the gluconeogenic program. AT, acetyltransferase.
Article Snippet:
Techniques: Expressing, Inhibition, Activation Assay